SimpleSearch - Line and FST details


Line specific information

 
Line ID 863H03
Vector Used pAC161
Line Availability available from GABI-Kat
Segregation Analysis unknown
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g01020

 
Sequence (A. th genome BLAST matches underlined)
>24-K025978-022-863-H03-8409
GTTAGGGTTCTTTCCCTTTCTAATACATTTCTAAATAAAGTAATAATCAAATATTAAACT
TTTAACTTACCGTTTCATTTTTATGTTGAGTTTACTTATATTGAAAGGAAACTATTTTAT
CTAAACCTCATTGTCAAATCTTTCATTTTGTAGCCATATGCTAATTACATGCAACAAAAG
GAGTTTTTTTTGTTTGGTGTGGCAAACGAAGATTTATTTACCTTTCTTATTTAATCAAAC
TAAATAAATTTCTTCACTGTTGAATTGTAATAAATAATTTATTTTCTTATAAACTTATCC
ATCACAACTCACAAGTCATGAACTATATATAGAAAGTAACACGACAGTAATAATATTAGT
GAACCACTAGACTTTTCAGTAAGTGTGGTAAATTCTGAAGACTAAATAATTTAGACTTAA
TATGTATATCTTTATCTGAGGCCTATAATATGTTTCATTCATGAACCTACGCATTTTAAA
ATGCTATGTCATATGGACAAGATTTTGATCCAAATTG
GenBank Accession CR403509 [GenBank]
Graphic View Graphic view of gene At1g01020
Predicted Position of Insertion Chr1:9401 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T25K16
Hit Gene Code At1g01020 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ARV1 family protein
Insertion Classification Promoter
Confirmation Status unknown


Last Updated on 31.08.2016 09:40