SimpleSearch - Line and FST details


Line specific information

 
Line ID 885D07
Vector Used pAC161
Line Availability available as T3 set from NASC (N484907)
Segregation Analysis N/A (line seemingly not resistant, T2 plants grown without drug)
Confirmed for Hit At1g08520
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g08520

 
Sequence (A. th genome BLAST matches underlined)
>52-K028920-022-885-D07-8409
GCATCAGGGAAGGATGACGAGACAAAAGATAGAGAAGCAAAAGTAAGCTGATAAGGTTTG
ATACAGTAGAAAATACTATCTCTTAACTTCTTCTTCTTCTTCTTCTTCTTCTCCTATCTT
TGAAAATGGCGATGACTCCGGTCGCGTCATCATCTCCAGTTTCAACCTGCAGACTCTTTC
GCTGCAATCTCCTCCCTGATCTCTTACCTAAGCCTCTGTTTCTCTCCCTCCCCAAACGAA
ACAGAATTGCCTCGTGCCGCTTCACTGAATGGGATCCTCCCTATAGTGAGTC
GenBank Accession CR935160 [GenBank]
Graphic View Graphic view of gene At1g08520
Predicted Position of Insertion Chr1:2696438 - go to primer design
BLAST e Value 2e-82
Hit Clone Code (BAC ID) T27G7
Hit Gene Code At1g08520 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ALBINA 1
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR935161 [GenBank]

 
Line 885D07 has other hits detected, show all hits of this line


Last Updated on 10.06.2021 13:37