DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_000573
Line Availability available from NASC (N500573) and ABRC (SALK_000573)
Confirmed for Hit At2g38950
Parent of DUPLO pair 8992
Parent of pair(s) none

Gene hit At2g38960

 
Sequence (A. th genome BLAST matches underlined)
GCTGATCGGAGCTATAGCTGCCGTTCCGCCAGCCGCCGTGGTCGCTGCGTTTTTGAATAC
TCAGAATT
GenBank Accession ED570819 [GenBank]
Graphic View Graphic view of gene At2g38960
Predicted Position of Insertion Chr2:16265520 - go to primer design
BLAST e Value 1e-19
Hit Clone Code (BAC ID) T7F6
Hit Gene Code At2g38960 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation endoplasmic reticulum oxidoreductins 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Other FSTs Supporting this Hit ED570819 [GenBank]

Gene hit At5g59490

 
Sequence (A. th genome BLAST matches underlined)
CTAAGATTACAATTTTATTTCATTTGATTTAGAATTGCATATCCACGGGAGGGATGATAA
CTATTTCTAGAATCATAAAATATGTCTCTTTGGCAGCGAAACCATGTATACTCTAGATTA
ATAAAAAGGACTCGGCGTCTATGTTGATTAATTAATACTCATTTTTAGAGA
GenBank Accession ED570820 [GenBank]
Graphic View Graphic view of gene At5g59490
Predicted Position of Insertion Chr5:23984864 - go to primer design
BLAST e Value 1e-61
Hit Clone Code (BAC ID) F2O15
Hit Gene Code At5g59490 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Haloacid dehalogenase-like hydrolase (HAD) superfamily protein
Insertion Classification Promoter
Confirmation Status unknown


Last Updated on Thursday, 10 June 2021 13:37