DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_000947
Line Availability available from NASC (N500947) and ABRC (SALK_000947)
Confirmed for Hit At1g67290
Parent of DUPLO pair 2683
Parent of pair(s) none

Gene hit At1g67290

 
Sequence (A. th genome BLAST matches underlined)
TTGCCGCAGGACCTGAGATGAATTGGCCTGGACAATGGGAGTTATTCATGAAGAATT
GenBank Accession ED571145 [GenBank]
Graphic View Graphic view of gene At1g67290
Predicted Position of Insertion Chr1:25192904 - go to primer design
BLAST e Value 3e-25
Hit Clone Code (BAC ID) F1N21
Hit Gene Code At1g67290 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation glyoxal oxidase-related protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37