DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_001056
Line Availability available from NASC (N501056) and ABRC (SALK_001056)
Confirmed for Hit At4g12730
Parent of DUPLO pair none
Parent of pair(s) 2564

Gene hit At4g12730

 
Sequence (A. th genome BLAST matches underlined)
AGCCAAGTCTTAACCTCGCCGGAAGCAGAAGCTCCCACGGCGAGTCCCAGCGACCTCATC
CTCACCACAATCCTCGAAAAACAAGGGTGCAAAGCT
GenBank Accession ED571200 [GenBank]
Graphic View Graphic view of gene At4g12730
Predicted Position of Insertion Chr4:7492299 - go to primer design
BLAST e Value 3e-48
Hit Clone Code (BAC ID) T20K18
Hit Gene Code At4g12730 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation FASCICLIN-like arabinogalactan 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37