DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_002232c
Line Availability available from NASC (N658490) and ABRC (SALK_002232c)
Confirmed for Hit At1g71190
Parent of DUPLO pair 552
Parent of pair(s) none

Gene hit At1g71190

 
Sequence (A. th genome BLAST matches underlined)
TTTGAACGGTTCTTTTCGCAAGCATGAGGGTAAGGAAGACAGGGACCATAGCGGCACACA
GATGCTTCAGAGAATGCCCACTAATAATATGATGAGTCCAGCTATATATAGGCTTATCCG
CAGCTTCTTCCACCTTGGCTAAGAGATAGAACCCTGCAATTCCAGACAATTGAATCTAGA
ATAAGAGCCAGAAAGTAACAACAAAGCT
GenBank Accession ED582263 [GenBank]
Graphic View Graphic view of gene At1g71190
Predicted Position of Insertion Chr1:26833787 - go to primer design
BLAST e Value 1e-114
Hit Clone Code (BAC ID) F23N20
Hit Gene Code At1g71190 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation senescence associated gene 18
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37