DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_003000c
Line Availability available from NASC (N665121) and ABRC (SALK_003000c)
Confirmed for Hit At1g78110
Parent of DUPLO pair 11775
Parent of pair(s) none

Gene hit At1g78110

 
Sequence (A. th genome BLAST matches underlined)
TCAATTTTTCCAGCTTCGACTCCGTAGACAGAGGATCTTGAATT
GenBank Accession queueing for submission to ENA/GenBank
Graphic View Graphic view of gene At1g78110
Predicted Position of Insertion Chr1:29392907 - go to primer design
BLAST e Value 8e-13
Hit Clone Code (BAC ID) T11I11
Hit Gene Code At1g78110 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation nucleolar GTP-binding protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37