DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_003739
Line Availability available from NASC (N503739) and ABRC (SALK_003739)
Confirmed for Hit At2g07750
Parent of DUPLO pair 12401
Parent of pair(s) none

Gene hit At2g07750

 
Sequence (A. th genome BLAST matches underlined) 
AAATTTTAACCGAACAAACCGAATTGATATAGTGAGTCGTAAGTGCCCTATAGTGAGTCT
TAATCTGGAATCACAATCAAAAACGTATAATTGAACTTATCAAATTCTTAGACACATATA
GTTCATCTTAGACGATCCTGATAATCTAAATCTGAATT
GenBank Accession ED603530 [GenBank]
Graphic View Graphic view of gene At2g07750
Predicted Position of Insertion Chr2:3576839 - go to primer design
BLAST e Value 5e-30
Hit Clone Code (BAC ID) T12J2
Hit Gene Code At2g07750 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation DEA(D/H)-box RNA helicase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit queueing for submission to ENA/GenBank


Last Updated on Thursday, 10 June 2021 13:37