DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_004270c
Line Availability available from NASC (N665144) and ABRC (SALK_004270c)
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g22230

 
Sequence (A. th genome BLAST matches underlined) 
GAAACACCAGCCGAACTCAGTAAGATTCTTCTCTCGATTTCTAATGTCTCCGACATTCAT
AATTCTCTCACTCAATCTGATTCTCTTAATCCCCCGAATT
GenBank Accession ED603994 [GenBank]
Graphic View Graphic view of gene At2g22230
Predicted Position of Insertion Chr2:9450225 - go to primer design
BLAST e Value 5e-29
Hit Clone Code (BAC ID) T26C19
Hit Gene Code At2g22230 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Thioesterase superfamily protein
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37