DUPLOdb - Line and FST details
Line specific information
Line ID | SALK_005743 |
Line Availability | available from NASC (N505743) and ABRC (SALK_005743) |
Confirmed for Hit | At2g25670 |
Parent of DUPLO pair | 12252 |
Parent of pair(s) | none |
Gene hit At2g25670
Sequence (A. th genome BLAST matches underlined) | ATAAATTAGCATTATAACGGAAACCAGCTCTCAGAATT |
GenBank Accession | ED606915 [GenBank] |
Graphic View | |
Predicted Position of Insertion | Chr2:10930156 - go to primer design |
BLAST e Value | 6e-07 |
Hit Clone Code (BAC ID) | F3N11 |
Hit Gene Code | At2g25670 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | hypothetical protein |
Insertion Classification | CDSi |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Last Updated on Thursday, 10 June 2021 13:37 |