DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_005849c
Line Availability available from NASC (N665165) and ABRC (SALK_005849c)
Confirmed for Hit At5g26740
Parent of DUPLO pair 2392
Parent of pair(s) none

Gene hit At5g26740

 
Sequence (A. th genome BLAST matches underlined)
GTTTACATAATCGTATACTGGTATTTCCTATCTGTTTGGATGATGAATTTGCTGTGCGAG
GAATACAATATTA
GenBank Accession ED607009 [GenBank]
Graphic View Graphic view of gene At5g26740
Predicted Position of Insertion Chr5:9293122 - go to primer design
BLAST e Value 2e-08
Hit Clone Code (BAC ID) F21E10
Hit Gene Code At5g26740 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation organic solute transporter ostalpha protein (DUF300)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37