DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_006148c
Line Availability available from NASC (N665172) and ABRC (SALK_006148c)
Confirmed for Hit At3g10090
Parent of DUPLO pair none
Parent of pair(s) 1783, 9033

Gene hit At3g10090

 
Sequence (A. th genome BLAST matches underlined) 
AGTATATCTAGCAGTGTACCTTATAATCAGACTACAAAAGAAATTCCAGAAAGAAATAAA
CTTGAAAACCAGTTTATAATATTTCTCAATCAACGTCAGAACCCTAACATACTTAAGCTC
AAAAGCT
GenBank Accession ED607287 [GenBank]
Graphic View Graphic view of gene At3g10090
Predicted Position of Insertion Chr3:3109602 - go to primer design
BLAST e Value 2e-66
Hit Clone Code (BAC ID) T22K18
Hit Gene Code At3g10090 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Nucleic acid-binding, OB-fold-like protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37