DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_008365c
Line Availability available from NASC (N656139) and ABRC (SALK_008365c)
Confirmed for Hit At2g19090
Parent of DUPLO pair 12275
Parent of pair(s) none

Gene hit At2g19090

 
Sequence (A. th genome BLAST matches underlined) 
CGGGTCAGAAAGCATGGAGCTTGTAGTGGCTGATAAGGGAGAAGAAGATGTTGTGATGAC
TGCTGAGAAACTTGCAGAGGTTGCTGTGAAGGTTCTCTGCCATGGAATGTCTGTTGCAGT
TAGTTCACTAGCTGAGTTTTCCATCAACTCGGCCGATGAACACTCGAAGCT
GenBank Accession ED609439 [GenBank]
Graphic View Graphic view of gene At2g19090
Predicted Position of Insertion Chr2:8265412 - go to primer design
BLAST e Value 1e-92
Hit Clone Code (BAC ID) T20K24
Hit Gene Code At2g19090 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation DUF630 family protein (DUF630 and DUF632)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37