DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_010185
Line Availability available from NASC (N510185) and ABRC (SALK_010185)
Confirmed for Hit At1g21780
Parent of DUPLO pair 230
Parent of pair(s) none

Gene hit At1g21780

 
Sequence (A. th genome BLAST matches underlined)
AGTCAGCATCAGGAGGATGAAGTATCGACCGACACGTGTCCGTTGCGTCCCAAAGTAAAT
CTGAAAGCTGGTTAAACCCTAAATCGCCCAAAAGGAAACACCTGTGAATTCTACCTGCTC
ACCGCTCCATCAACTTGGCTGGCGATACTGCTGATTTCATCTCTGACATCATAAATCTTT
CCGAAATCAAACAAATACATCAAACACCCTTTCTTCAGCTTCTCCAGCTGATAAAGCCAA
GCT
GenBank Accession ED610851 [GenBank]
Graphic View Graphic view of gene At1g21780
Predicted Position of Insertion Chr1:7653791 - go to primer design
BLAST e Value 1e-43
Hit Clone Code (BAC ID) F8K7
Hit Gene Code At1g21780 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation BTB/POZ domain-containing protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37