DUPLOdb - Line and FST details
Line specific information
Line ID | SALK_010370c |
Line Availability | available from NASC (N661451) and ABRC (SALK_010370c) |
Confirmed for Hit | At4g36830 |
Parent of DUPLO pair | 11734 |
Parent of pair(s) | none |
Gene hit At4g36830
Sequence (A. th genome BLAST matches underlined) | CGATAGAATCGCTAGAATCTGGTACGACTGCGAGAATT |
GenBank Accession | ED571399 [GenBank] |
Graphic View | |
Predicted Position of Insertion | Chr4:17350077 - go to primer design |
BLAST e Value | 4e-14 |
Hit Clone Code (BAC ID) | AP22 |
Hit Gene Code | At4g36830 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | GNS1/SUR4 membrane protein family |
Insertion Classification | CDSi |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Last Updated on Thursday, 10 June 2021 13:37 |