DUPLOdb - Line and FST details
Line specific information
Line ID | SALK_012134c |
Line Availability | available from NASC (N654505) and ABRC (SALK_012134c) |
Confirmed for Hit | At1g07750 |
Parent of DUPLO pair | 821 |
Parent of pair(s) | none |
Gene hit At1g07750
Sequence (A. th genome BLAST matches underlined) | TGGTTCTCAAACCGGTAATGGCATTGTGAAGCT |
GenBank Accession | ED572733 [GenBank] |
Graphic View | |
Predicted Position of Insertion | Chr1:2404979 - go to primer design |
BLAST e Value | 3e-11 |
Hit Clone Code (BAC ID) | F24B9 |
Hit Gene Code | At1g07750 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | RmlC-like cupins superfamily protein |
Insertion Classification | CDSi |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Other FSTs Supporting this Hit | queueing for submission to ENA/GenBank |
Last Updated on Thursday, 10 June 2021 13:37 |