DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_012134c
Line Availability available from NASC (N654505) and ABRC (SALK_012134c)
Confirmed for Hit At1g07750
Parent of DUPLO pair 821
Parent of pair(s) none

Gene hit At1g07750

 
Sequence (A. th genome BLAST matches underlined)
TGGTTCTCAAACCGGTAATGGCATTGTGAAGCT
GenBank Accession ED572733 [GenBank]
Graphic View Graphic view of gene At1g07750
Predicted Position of Insertion Chr1:2404979 - go to primer design
BLAST e Value 3e-11
Hit Clone Code (BAC ID) F24B9
Hit Gene Code At1g07750 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RmlC-like cupins superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit queueing for submission to ENA/GenBank


Last Updated on Thursday, 10 June 2021 13:37