DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_012424c
Line Availability available from NASC (N660306) and ABRC (SALK_012424c)
Confirmed for Hit At2g20430
Parent of DUPLO pair 12187
Parent of pair(s) none

Gene hit At2g20430

 
Sequence (A. th genome BLAST matches underlined)
TATATATGACCTCGTAGATTTGAGTCAAGTATTAA
GenBank Accession ED572992 [GenBank]
Graphic View Graphic view of gene At2g20430
Predicted Position of Insertion Chr2:8809196 - go to primer design
BLAST e Value 2e-12
Hit Clone Code (BAC ID) F11A3
Hit Gene Code At2g20430 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ROP-interactive CRIB motif-containing protein 6
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BH747199 [GenBank] ED572992 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37