DUPLOdb - Line and FST details
Line specific information
Line ID | SALK_012424c |
Line Availability | available from NASC (N660306) and ABRC (SALK_012424c) |
Confirmed for Hit | At2g20430 |
Parent of DUPLO pair | 12187 |
Parent of pair(s) | none |
Gene hit At2g20430
Sequence (A. th genome BLAST matches underlined) | TATATATGACCTCGTAGATTTGAGTCAAGTATTAA |
GenBank Accession | ED572992 [GenBank] |
Graphic View | |
Predicted Position of Insertion | Chr2:8809196 - go to primer design |
BLAST e Value | 2e-12 |
Hit Clone Code (BAC ID) | F11A3 |
Hit Gene Code | At2g20430 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | ROP-interactive CRIB motif-containing protein 6 |
Insertion Classification | CDSi |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Other FSTs Supporting this Hit | BH747199 [GenBank] ED572992 [GenBank] |
Last Updated on Thursday, 10 June 2021 13:37 |