DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_012425
Line Availability available from NASC (N512425) and ABRC (SALK_012425)
Confirmed for Hit At5g63570
Parent of DUPLO pair 2203
Parent of pair(s) none

Gene hit At1g47578

 
Sequence (A. th genome BLAST matches underlined)
GAATACTGTGTGCTTTACCATCTGAAGCTGAAAAACTTCATAGAATT
GenBank Accession ED572993 [GenBank]
Graphic View Graphic view of gene At1g47578
Predicted Position of Insertion Chr1:17485455 - go to primer design
BLAST e Value 3e-12
Hit Clone Code (BAC ID) F16N3
Hit Gene Code At1g47578 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Biotin/lipoate A/B protein ligase family
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At5g63570

 
Sequence (A. th genome BLAST matches underlined)
TTCAACGTATGACTCCCCGCAGTCATTGCCCGCGCATTACCTCTTAGAGTCCCCGCTTGG
GACATTGTTCCAGCGAGAGCAACCTACAACAAAAA
GenBank Accession ED572994 [GenBank]
Graphic View Graphic view of gene At5g63570
Predicted Position of Insertion Chr5:25453280 - go to primer design
BLAST e Value 6e-19
Hit Clone Code (BAC ID) MLE2
Hit Gene Code At5g63570 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation glutamate-1-semialdehyde-2,1-aminomutase
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37