DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_012558c
Line Availability available from NASC (N673854) and ABRC (SALK_012558c)
Confirmed for Hit At5g66140
Parent of DUPLO pair 2257
Parent of pair(s) none

Gene hit At5g66140

 
Sequence (A. th genome BLAST matches underlined)
AAATAACAAAATATCAGCTAGGACGGAGAGGGCACCAACCTCAAGCAGAGCACGGATAGC
GAGTTTAATAGTTTCTTGGCCAGAGGATTCTTTGTAGTTCTTCTCGAGGAATT
GenBank Accession ED573127 [GenBank]
Graphic View Graphic view of gene At5g66140
Predicted Position of Insertion Chr5:26437666 - go to primer design
BLAST e Value 3e-58
Hit Clone Code (BAC ID) K2A18
Hit Gene Code At5g66140 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation proteasome alpha subunit D2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit queueing for submission to ENA/GenBank


Last Updated on Thursday, 10 June 2021 13:37