DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_012950
Line Availability available from NASC (N512950) and ABRC (SALK_012950)
Parent of DUPLO pair none
Parent of pair(s) 609

Gene hit At1g77540

 
Sequence (A. th genome BLAST matches underlined)
GCTTCCATGATGGGTTTCGAGGAAGAAACGTATCCTGCAAAATACACAAAGCTCACGAAT
T
GenBank Accession ED573314 [GenBank]
Graphic View Graphic view of gene At1g77540
Predicted Position of Insertion Chr1:29137800 - go to primer design
BLAST e Value 2e-27
Hit Clone Code (BAC ID) T5M16
Hit Gene Code At1g77540 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Acyl-CoA N-acyltransferases (NAT) superfamily protein
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37