DUPLOdb - Line and FST details
Line specific information
Line ID | SALK_012997c |
Line Availability | available from NASC (N661529) and ABRC (SALK_012997c) |
Confirmed for Hit | At1g62300 |
Parent of DUPLO pair | none |
Parent of pair(s) | 1463 |
Gene hit At1g62300
Sequence (A. th genome BLAST matches underlined) | TGTAACTGTTGCTAACTTGTGTAAGCAATTCTCTAAGCT |
GenBank Accession | ED573345 [GenBank] |
Graphic View | |
Predicted Position of Insertion | Chr1:23018301 - go to primer design |
BLAST e Value | 1e-14 |
Hit Clone Code (BAC ID) | F19K23 |
Hit Gene Code | At1g62300 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | WRKY family transcription factor |
Insertion Classification | CDSi |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Other FSTs Supporting this Hit | ED573345 [GenBank] |
Last Updated on Thursday, 10 June 2021 13:37 |