DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_013130
Line Availability available from NASC (N513130) and ABRC (SALK_013130)
Confirmed for Hit At5g27700
Parent of DUPLO pair none
Parent of pair(s) 1975

Gene hit At5g27700

 
Sequence (A. th genome BLAST matches underlined)
TAGCATAACTGCCAATATTCAGTCAAGACAAACAACCAAGAACCAATCTTGTCTTAGTTA
ATGAGAGAAGCAAAACAGAGACCGTAACCTAAGAAGAAGACATGATTCTCATTACCATTT
CCTAGGAATGTAAA
GenBank Accession BH758019 [GenBank]
Graphic View Graphic view of gene At5g27700
Predicted Position of Insertion Chr5:9807883 - go to primer design
BLAST e Value 1e-42
Hit Clone Code (BAC ID) T1G16
Hit Gene Code At5g27700 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ribosomal protein S21e
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37