DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_013618c
Line Availability available from NASC (N665312) and ABRC (SALK_013618c)
Confirmed for Hit At5g15790
Parent of DUPLO pair 12727
Parent of pair(s) none

Gene hit At5g15790

 
Sequence (A. th genome BLAST matches underlined) 
AGAAGCACATGCGTAAAATCTTTACTTGTGCTTGTCTATGACAAATATGGCTAATCATTC
TTCCTGAAACTCAGAACATTTGAATTATTTCTCATTCATGTTGACTAAAGAATATTTTTT
TCTCTGCTGTGAATTGATTTGTAACAATCTTCGGGTTCTCTGATATGTATTCTACAAAAC
ACACGAAATAATCTGATACTAAGCT
GenBank Accession ED573823 [GenBank]
Graphic View Graphic view of gene At5g15790
Predicted Position of Insertion Chr5:5150790 - go to primer design
BLAST e Value 9e-54
Hit Clone Code (BAC ID) F14F8
Hit Gene Code At5g15790 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RING/U-box superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit ED573823 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37