DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_014042
Line Availability available from NASC (N514042) and ABRC (SALK_014042)
Confirmed for Hit At1g01550
Parent of DUPLO pair none
Parent of pair(s) 963, 85527

Gene hit At1g01550

 
Sequence (A. th genome BLAST matches underlined) 
ACTGTCTCATGGATGAAACAAGCTATGGAATCTCTTTGGCGAGACACATAATGGTATCAA
GACCCTTATAACCGATCTTGAGCTTCCTGTATCAGATTGGGAGGATAAATGGGTTGATGT
CTATCTTGACATTAGTGTGAAGCT
GenBank Accession BH752295 [GenBank]
Graphic View Graphic view of gene At1g01550
Predicted Position of Insertion Chr1:200703 - go to primer design
BLAST e Value 8e-72
Hit Clone Code (BAC ID) F22L4
Hit Gene Code At1g01550 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation BPS1-like protein (DUF793)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit ED574275 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37