DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_014278c
Line Availability available from NASC (N682019) and ABRC (SALK_014278c)
Confirmed for Hit At4g33770
Parent of DUPLO pair 2545
Parent of pair(s) none

Gene hit At4g33770

 
Sequence (A. th genome BLAST matches underlined)
ATTTTGGCAGAAATCTACCCAGACTTGCTCGAACCCTGTTAGTTCTCTGTAACCCGCAAA
TCCACATCTTACAGATAAAACTTTTCTTCTCTGCTTCCATGAG
GenBank Accession ED574455 [GenBank]
Graphic View Graphic view of gene At4g33770
Predicted Position of Insertion Chr4:16193631 - go to primer design
BLAST e Value 6e-07
Hit Clone Code (BAC ID) T16L1
Hit Gene Code At4g33770 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Inositol 1,3,4-trisphosphate 5/6-kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37