DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_014625
Line Availability available from NASC (N514625) and ABRC (SALK_014625)
Confirmed for Hit At3g02780
Parent of DUPLO pair 1895
Parent of pair(s) none

Gene hit At3g02780

 
Sequence (A. th genome BLAST matches underlined)
ATGCTGAACAAGGCTCCTTCTGATGGCAAATGGGGAGAGCATGAACGTAAATACCATTTC
TCAAGACTCTTGGTTCCCATTTTCTTGAACAGAATAATAAAACCTTAAGCT
GenBank Accession ED574702 [GenBank]
Graphic View Graphic view of gene At3g02780
Predicted Position of Insertion Chr3:602966 - go to primer design
BLAST e Value 1e-54
Hit Clone Code (BAC ID) F13E7
Hit Gene Code At3g02780 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation isopentenyl pyrophosphate:dimethylallyl pyrophosphate isomerase 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit queueing for submission to ENA/GenBank


Last Updated on Thursday, 10 June 2021 13:37