DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_015003c
Line Availability available from NASC (N685307) and ABRC (SALK_015003c)
Parent of DUPLO pair 11764
Parent of pair(s) none

Gene hit At3g49730

 
Sequence (A. th genome BLAST matches underlined)
CAAAAAACCATCTTCTCAAGCAAATTCTAGAATTGATCTCATTTGTAAAAGGTTCCATAT
TTCAAGAGTTCTCAATAACGATTTCGTAGAATCAACAGAGAGAAAGAATGGGGTTGGTTT
AGTTTGTCCAGAGAAGCATGAAGATGAATT
GenBank Accession ED575088 [GenBank]
Graphic View Graphic view of gene At3g49730
Predicted Position of Insertion Chr3:18447608 - go to primer design
BLAST e Value 3e-80
Hit Clone Code (BAC ID) T16K5
Hit Gene Code At3g49730 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Tetratricopeptide repeat (TPR)-like superfamily protein
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37