DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_015099c
Line Availability available from NASC (N678138) and ABRC (SALK_015099c)
Confirmed for Hit At1g10650
Parent of DUPLO pair 2617
Parent of pair(s) none

Gene hit At1g10650

 
Sequence (A. th genome BLAST matches underlined) 
AGACTCATTGTACTGTGCTCTGCAGCGACAATTCTGAGCTTCCATTGCGACTTGCTGTAT
CCGCTCCACAGGCTCGTTATTCTGCGTGTTCATATCATTGCATCTCGTGGTCCTTCTCTA
GAAGCT
GenBank Accession ED575184 [GenBank]
Graphic View Graphic view of gene At1g10650
Predicted Position of Insertion Chr1:3524449 - go to primer design
BLAST e Value 4e-30
Hit Clone Code (BAC ID) F20B24
Hit Gene Code At1g10650 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation SBP (S-ribonuclease binding protein) family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37