DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_017090c
Line Availability available from NASC (N661644) and ABRC (SALK_017090c)
Confirmed for Hit At5g60640
Parent of DUPLO pair 2360
Parent of pair(s) none

Gene hit At5g60640

 
Sequence (A. th genome BLAST matches underlined) 
TTAGTAAACGGACCTACACCATCTTCGAATTTAAAACAAAAAATCCTACTAAAACCATTG
ACAGACCTGTTTCTTGATTGCACTCTCAAAAATTTCCGGAGCAGTCTCTCTGGTGAAAAC
AGAGACCAAAGCAAGCT
GenBank Accession ED576633 [GenBank]
Graphic View Graphic view of gene At5g60640
Predicted Position of Insertion Chr5:24372664 - go to primer design
BLAST e Value 2e-72
Hit Clone Code (BAC ID) MUP24
Hit Gene Code At5g60640 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation PDI-like 1-4
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit ED576632 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37