DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_017111c
Line Availability available from NASC (N661645) and ABRC (SALK_017111c)
Confirmed for Hit At1g71020
Parent of DUPLO pair 2401
Parent of pair(s) none

Gene hit At1g71020

 
Sequence (A. th genome BLAST matches underlined) 
GTCCTCTGTAAGCATTCTAAACCATTCTCAACGATTGAAAATGGATTTGTGATTTCACGA
AGATTTGGTCTCGCCATGGCAGGAACGTAATTTATAGGAAGAATTTGTTTTTAGTTTTTT
TAGATTGGAAGATACTATTGTTGACATTTGTGTAGTGAAGAGCATTATTAATAT
GenBank Accession BH857573 [GenBank]
Graphic View Graphic view of gene At1g71020
Predicted Position of Insertion Chr1:26792818 - go to primer design
BLAST e Value 2e-69
Hit Clone Code (BAC ID) F15H11
Hit Gene Code At1g71020 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ARM repeat superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37