DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_017956
Line Availability available from NASC (N517956) and ABRC (SALK_017956)
Confirmed for Hit At1g35470
Parent of DUPLO pair 2274
Parent of pair(s) none

Gene hit At1g35470

 
Sequence (A. th genome BLAST matches underlined)
GGGAAAAGGTGAACCTTTTGGTCCAAAGTTTACAAAAGATGATGCAGTTGGCGGTGGTAT
AAACTACGCTTCTCAGGAGTTCTTTTTCACGTAAGAAAGAAACTGTTTCATGTTTTTTGG
TACTTAAATAAGTTCATTACTACTGTGAGTTGAATT
GenBank Accession ED577295 [GenBank]
Graphic View Graphic view of gene At1g35470
Predicted Position of Insertion Chr1:13054038 - go to primer design
BLAST e Value 1e-83
Hit Clone Code (BAC ID) F12A4
Hit Gene Code At1g35470 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation SPla/RYanodine receptor (SPRY) domain-containing protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37