DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_018002c
Line Availability available from NASC (N654524) and ABRC (SALK_018002c)
Confirmed for Hit At1g12380
Parent of DUPLO pair 12607
Parent of pair(s) none

Gene hit At1g12380

 
Sequence (A. th genome BLAST matches underlined) 
TGATCCTTCTAGATTCTGCGGCGGAGAGTTGCATTATTCAACTCCTCCGCCGCCGCAGCA
TTTGATGCTCTCCGGTGGAAAAGATGACTTGGGTCCTTTAGCTATGCTTGAAGACAGTGT
GAAGAAGCT
GenBank Accession ED577322 [GenBank]
Graphic View Graphic view of gene At1g12380
Predicted Position of Insertion Chr1:4216359 - go to primer design
BLAST e Value 1e-67
Hit Clone Code (BAC ID) F5O11
Hit Gene Code At1g12380 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation hypothetical protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37