DUPLOdb - Line and FST details
Line specific information
Line ID | SALK_018180c |
Line Availability | available from NASC (N665408) and ABRC (SALK_018180c) |
Parent of DUPLO pair | 12126 |
Parent of pair(s) | none |
Gene hit At5g66450
Sequence (A. th genome BLAST matches underlined) | TTTGGGGTATAAGACGTGGTTAAGGGTTTCTCAGAAGCT |
GenBank Accession | ED577471 [GenBank] |
Graphic View | |
Predicted Position of Insertion | Chr5:26535712 - go to primer design |
BLAST e Value | 6e-10 |
Hit Clone Code (BAC ID) | K1F13 |
Hit Gene Code | At5g66450 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | Phosphatidic acid phosphatase (PAP2) family protein |
Insertion Classification | CDSi |
Confirmation Status | failed |
Last Updated on Thursday, 10 June 2021 13:37 |