DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_018319
Line Availability available from NASC (N518319) and ABRC (SALK_018319)
Confirmed for Hit At3g42670
Parent of DUPLO pair 12038
Parent of pair(s) none

Gene hit At3g42670

 
Sequence (A. th genome BLAST matches underlined)
CCATGTACTTCCTATGAGCAAGCTTTGAATCCTCGCACGTCAAACTTCCAAGCCATGTGG
AAGCCCTTACTAGAACACTCGGCTGTGCATGCCATCTCTGGATTGTGGCTGAACAGTCAA
GAACATGCATAACATCTTGGCTTGGCCTTGGAATT
GenBank Accession BH758254 [GenBank]
Graphic View Graphic view of gene At3g42670
Predicted Position of Insertion Chr3:14757171 - go to primer design
BLAST e Value 5e-33
Hit Clone Code (BAC ID) T12K4
Hit Gene Code At3g42670 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation chromatin remodeling 38
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37