DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_019921
Line Availability available from NASC (N519921) and ABRC (SALK_019921)
Parent of DUPLO pair 2698
Parent of pair(s) none

Gene hit At2g27760

 
Sequence (A. th genome BLAST matches underlined)
ATGCATTGATGCAGCCCCAGTTCGGCCCTGACGAAACACCTTAGTTAATTAACTTCTCAG
AGCAGCTAAGCT
GenBank Accession ED577830 [GenBank]
Graphic View Graphic view of gene At2g27760
Predicted Position of Insertion Chr2:11826436 - go to primer design
BLAST e Value 2e-24
Hit Clone Code (BAC ID) F15K20
Hit Gene Code At2g27760 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation tRNAisopentenyltransferase 2
Insertion Classification CDSi
Confirmation Status unknown
Other FSTs Supporting this Hit ED577829 [GenBank]

Gene hit At3g59440

 
Sequence (A. th genome BLAST matches underlined)
GTGATGGATTTATCACTGTTGAGGAGTTGAATT
GenBank Accession BH753225 [GenBank]
Graphic View Graphic view of gene At3g59440
Predicted Position of Insertion Chr3:21970826 - go to primer design
BLAST e Value 3e-11
Hit Clone Code (BAC ID) F25L23
Hit Gene Code At3g59440 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Calcium-binding EF-hand family protein
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37