DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_020311
Line Availability available from NASC (N520311) and ABRC (SALK_020311)
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g40290

 
Sequence (A. th genome BLAST matches underlined)
CTAATTTAAGATACTCACAGCTCTAGCCCCCTCCTTAACGACAAGCT
GenBank Accession BZ286964 [GenBank]
Graphic View Graphic view of gene At2g40290
Predicted Position of Insertion Chr2:16829305 - go to primer design
BLAST e Value 2e-19
Hit Clone Code (BAC ID) T7M7
Hit Gene Code At2g40290 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Eukaryotic translation initiation factor 2 subunit 1
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37