DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_021513
Line Availability available from NASC (N521513) and ABRC (SALK_021513)
Confirmed for Hit At2g20000
Parent of DUPLO pair 2573
Parent of pair(s) none

Gene hit At2g20000

 
Sequence (A. th genome BLAST matches underlined)
CTAGAGAAAACAAATTCAACAAGAGAGAGAAAAGAACACGAATT
GenBank Accession BZ288130 [GenBank]
Graphic View Graphic view of gene At2g20000
Predicted Position of Insertion Chr2:8636499 - go to primer design
BLAST e Value 1e-17
Hit Clone Code (BAC ID) T2G17
Hit Gene Code At2g20000 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation CDC27 family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37