DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_021893c
Line Availability available from NASC (N661787) and ABRC (SALK_021893c)
Confirmed for Hit At5g25360
Parent of DUPLO pair 12601
Parent of pair(s) none

Gene hit At5g25360

 
Sequence (A. th genome BLAST matches underlined) 
ATGTTTTGATGCCTCGCTCATGCATATTTAATGAATCCTCCTACTATTCTGGGATAAATA
CACTTTAACTCCAAAGTTTGGTGGATGAAAAAGTAAAGCTGGGCCTCTGCTT
GenBank Accession BZ288507 [GenBank]
Graphic View Graphic view of gene At5g25360
Predicted Position of Insertion Chr5:8800334 - go to primer design
BLAST e Value 3e-12
Hit Clone Code (BAC ID) F18G18
Hit Gene Code At5g25360 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation hypothetical protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37