DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_022192c
Line Availability available from NASC (N661803) and ABRC (SALK_022192c)
Confirmed for Hit At5g18240
Parent of DUPLO pair 2529
Parent of pair(s) none

Gene hit At5g18240

 
Sequence (A. th genome BLAST matches underlined)
AAAACTATGGCACAACGCGTCCTAAACAGTTTGATTTAAATGGTTTCAGCTGGAATTGAG
AAGAACAAATAAGCT
GenBank Accession BZ288802 [GenBank]
Graphic View Graphic view of gene At5g18240
Predicted Position of Insertion Chr5:6028675 - go to primer design
BLAST e Value 9e-36
Hit Clone Code (BAC ID) MRG7
Hit Gene Code At5g18240 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb-related protein 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37