DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_022805c
Line Availability available from NASC (N670393) and ABRC (SALK_022805c)
Confirmed for Hit At5g40860
Parent of DUPLO pair 2019
Parent of pair(s) none

Gene hit At5g40860

 
Sequence (A. th genome BLAST matches underlined)
GTGCTCTAGTGAAATCTCGGTGGTCGTTTTCTTCTTCTAAGAGAAGCT
GenBank Accession BZ289408 [GenBank]
Graphic View Graphic view of gene At5g40860
Predicted Position of Insertion Chr5:16370772 - go to primer design
BLAST e Value 2e-17
Hit Clone Code (BAC ID) MHK7
Hit Gene Code At5g40860 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation transmembrane protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37