DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_023915c
Line Availability available from NASC (N657174) and ABRC (SALK_023915c)
Confirmed for Hit At4g13940
Parent of DUPLO pair 1213
Parent of pair(s) none

Gene hit At4g13940

 
Sequence (A. th genome BLAST matches underlined)
TGTTGCACACATCTAGCGTTGATCTTGATCTTGCTCATGTGGCCGACCATGATGATGTCT
TTGTTACTGTTGGTGGTGACAAAGATATCAGCTTCTGAGACAACATCCTCAAGGGTAAGA
ACCTGAAGTCCTTCCATCAAAGCT
GenBank Accession BZ660466 [GenBank]
Graphic View Graphic view of gene At4g13940
Predicted Position of Insertion Chr4:8056260 - go to primer design
BLAST e Value 4e-55
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g13940 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation S-adenosyl-L-homocysteine hydrolase
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BZ660466 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37