DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_024321
Line Availability available from NASC (N524321) and ABRC (SALK_024321)
Confirmed for Hit At1g76620
Parent of DUPLO pair 2693
Parent of pair(s) none

Gene hit At1g76620

 
Sequence (A. th genome BLAST matches underlined)
CTGTTACTACTACCTTACCTCGTTCTGTGACTACTGCACCAACATCACTAACTCATTATC
AAGCT
GenBank Accession BZ660860 [GenBank]
Graphic View Graphic view of gene At1g76620
Predicted Position of Insertion Chr1:28757415 - go to primer design
BLAST e Value 2e-27
Hit Clone Code (BAC ID) F14G6
Hit Gene Code At1g76620 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Serine/Threonine-kinase, putative (Protein of unknown function, DUF547)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37