DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_024636c
Line Availability available from NASC (N657899) and ABRC (SALK_024636c)
Confirmed for Hit At5g12010
Parent of DUPLO pair 2707
Parent of pair(s) none

Gene hit At5g12010

 
Sequence (A. th genome BLAST matches underlined)
CGTCAGCGAGTCGCGGTTTGTATATGGAGATTAGCCACCGGTGAGCCACTTCGTCTTGTC
NCTAAGAAGTTTGGTTTAGGAATCTCAACTTGTCACAAGCT
GenBank Accession BZ661170 [GenBank]
Graphic View Graphic view of gene At5g12010
Predicted Position of Insertion Chr5:3878853 - go to primer design
BLAST e Value 6e-47
Hit Clone Code (BAC ID) F14F18
Hit Gene Code At5g12010 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation nuclease
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37