DUPLOdb - Line and FST details
Line specific information
Line ID | SALK_024971c |
Line Availability | available from NASC (N678259) and ABRC (SALK_024971c) |
Confirmed for Hit | At5g13120 |
Parent of DUPLO pair | none |
Parent of pair(s) | none |
Gene hit At5g13120
Sequence (A. th genome BLAST matches underlined) | TTGAGAAGGGCAATGTGAGTTTTTCTGGCTGAATT |
GenBank Accession | BZ661500 [GenBank] |
Graphic View | |
Predicted Position of Insertion | Chr5:4164017 - go to primer design |
BLAST e Value | 2e-12 |
Hit Clone Code (BAC ID) | T19L5 |
Hit Gene Code | At5g13120 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | cyclophilin 20-2 |
Insertion Classification | CDSi |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Last Updated on Thursday, 10 June 2021 13:37 |