DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_025557c
Line Availability available from NASC (N667987) and ABRC (SALK_025557c)
Confirmed for Hit At3g03480
Parent of DUPLO pair 2755
Parent of pair(s) none

Gene hit At3g03480

 
Sequence (A. th genome BLAST matches underlined)
CTTGTATCAACCTCAAAGCAAACTCAAGCGGTTTCTCTATTAGATCTCTTGCTGTCGCTA
TTGCCGCGGGAATGACAAACACATTTCCGTAGTAACCAGGCTCTAGCGGTGGGTTTCTAA
GCT
GenBank Accession BZ662073 [GenBank]
Graphic View Graphic view of gene At3g03480
Predicted Position of Insertion Chr3:828735 - go to primer design
BLAST e Value 4e-64
Hit Clone Code (BAC ID) T21P5
Hit Gene Code At3g03480 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation acetyl CoA:(Z)-3-hexen-1-ol acetyltransferase
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37