DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_025582
Line Availability available from NASC (N525582) and ABRC (SALK_025582)
Parent of DUPLO pair 2626
Parent of pair(s) none

Gene hit At2g35760

 
Sequence (A. th genome BLAST matches underlined)
CCTGATGGGCGAAGAAAATGGCCCAAGCCAGAGGCTGACAAAACAAAACGTCGTCCTTTG
ATGAAGGCCACCACGCAATACTCGTTCTGAACCAAAGAATACCCCGCGGCTATGCCATTG
ACGACCACCAAAAGCCGGAACTCAGAGAACGATCGTTACGAAAGTCGCCATCTTTACACA
AAAGCCCTAAAATCGAGGAATCTCTGTCATGAAGCT
GenBank Accession BZ662098 [GenBank]
Graphic View Graphic view of gene At2g35760
Predicted Position of Insertion Chr2:15032497 - go to primer design
BLAST e Value 1e-52
Hit Clone Code (BAC ID) T20F21
Hit Gene Code At2g35760 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Uncharacterized protein family (UPF0497)
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37