DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_025904
Line Availability available from NASC (N525904) and ABRC (SALK_025904)
Parent of DUPLO pair none
Parent of pair(s) 2217

Gene hit At5g10090

 
Sequence (A. th genome BLAST matches underlined)
CATANCAAGACTGAGTTTCTTGAGTCGTGGTCTAACCCTTCGCCATAAGCCGCACAAGCT

GenBank Accession BZ662418 [GenBank]
Graphic View Graphic view of gene At5g10090
Predicted Position of Insertion Chr5:3154069 - go to primer design
BLAST e Value 9e-23
Hit Clone Code (BAC ID) T31P16
Hit Gene Code At5g10090 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Tetratricopeptide repeat (TPR)-like superfamily protein
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37