DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_026574c
Line Availability available from NASC (N661930) and ABRC (SALK_026574c)
Confirmed for Hit At5g50300
Parent of DUPLO pair 1074
Parent of pair(s) none

Gene hit At5g50300

 
Sequence (A. th genome BLAST matches underlined)
CCCTACGATAACGGGCGTTACCCCCGTTTCCCCTGCTTCTTTCGACCCCGCCCAGGACTC
CACAAAGGTCGGCGTCGTTGT
GenBank Accession BZ663080 [GenBank]
Graphic View Graphic view of gene At5g50300
Predicted Position of Insertion Chr5:20466834 - go to primer design
BLAST e Value 8e-18
Hit Clone Code (BAC ID) K6A12
Hit Gene Code At5g50300 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Xanthine/uracil permease family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37