DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_026686
Line Availability available from NASC (N526686) and ABRC (SALK_026686)
Confirmed for Hit At1g69090
Parent of DUPLO pair 12277
Parent of pair(s) none

Gene hit At1g69090

 
Sequence (A. th genome BLAST matches underlined)
ATCAAAAACCAACTTCTATTAGTCGCCAAAACAATACTCTTTTCAAAATTCGTACCGAGA
TGTTGAGTTTTTTAGAGATTTTCTTTATCTTCCGGGGCGAATCAGAAAAAATAATTATTG
TCTGTTGGGAGTAGAATCA
GenBank Accession BZ663191 [GenBank]
Graphic View Graphic view of gene At1g69090
Predicted Position of Insertion Chr1:25978345 - go to primer design
BLAST e Value 3e-31
Hit Clone Code (BAC ID) F4N2
Hit Gene Code At1g69090 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation F-box protein (DUF295)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37