DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_026969c
Line Availability available from NASC (N678286) and ABRC (SALK_026969c)
Confirmed for Hit At5g47730
Parent of DUPLO pair 2085
Parent of pair(s) none

Gene hit At5g47730

 
Sequence (A. th genome BLAST matches underlined) 
TAAAAAGTCTGTTCCTTTTTTCTCAATGAACCTACGAAAACAACAGAGGGGGGGGGAGAG
CGTTGAAATAGTAAAGAGAAAAATTCAATTGGAGGATGAAATTCGACCACTTGCTAAAGC
T
GenBank Accession BZ663372 [GenBank]
Graphic View Graphic view of gene At5g47730
Predicted Position of Insertion Chr5:19336961 - go to primer design
BLAST e Value 1e-20
Hit Clone Code (BAC ID) MCA23
Hit Gene Code At5g47730 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Sec14p-like phosphatidylinositol transfer family protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37